snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR58Y-1
sequence
ACTTCTGCTGTGATGATCTTTTGAATAAAATTCACATGTCAGACTTCAGAGATCTTTTG
ATCTATGAGAAAAAACATTCATAATTCTGAGCAGAAGT
  Box motif
  Complementary to target RNA
length 97
organism Arabidopsis_thaliana
snoRNA name SnoR58Y-1
alias
chromosome ⁄ contig 5
locus ⁄ host gene Poly:SnoR13-1
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:C674,25S:A3095
accession no AF317988,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved