snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR53Y
sequence
ATTCCCTATGATGGTAATAACCATGCTAATACTGATGTCTTGTGACTGAATCAAAGTTA
TGTGTCTGAGGGAATT
  Box motif
  Complementary to target RNA
length 75
organism Arabidopsis_thaliana
snoRNA name SnoR53Y
alias
chromosome ⁄ contig 1
locus ⁄ host gene poly:SnoR69Y
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 25S:U2400,18S:A799
accession no AJ505643,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved