snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR5a
sequence
GCCTATGGTATCTGATGTCCAAAGTTTGATAATTGTGTTTGGACATTTCGTTTTTCTTA
GGCAGAAAGTGATTTCAGGCTTTGCGACACTGTTAGCTTATCACATAAGCTACCTGTTAC
TTTTAATACCTGGTTACATCT
  Box motif
  Complementary to target RNA
length 140
organism Arabidopsis_thaliana
snoRNA name SnoR5a
alias
chromosome ⁄ contig 1
locus ⁄ host gene poly:U31a
organization Poly
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1003,18S:U1121
accession no NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved