snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR44-1b
sequence
tgcaagtgacgatgaatagacagggacatcagaagttctataatgatgactaatgtcta
gatgggaatctctctgatgca
  Box motif
  Complementary to target RNA
length 80
organism Arabidopsis_thaliana
snoRNA name SnoR44-1b
alias
chromosome ⁄ contig 1
locus ⁄ host gene poly:SnoR44-1a
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:A2316,25S:C2327
accession no AF317960,NC_003070,CP002684
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved