snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR4a
sequence
GGATATGATGAAATGGCAATAATGTTTTGTGACACCCAGTCTGATCTTCGTGATTGATT
TGCCATATTTTCTGATCC
  Box motif
  Complementary to target RNA
length 77
organism Arabidopsis_thaliana
snoRNA name SnoR4a
alias
chromosome ⁄ contig 1
locus ⁄ host gene poly:U31a
organization Poly
target RNA 5.8S rRNA
modification type C/D
modification site 5.8S:Unknown
accession no NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved