snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana 39BYb
sequence
AGCCGATGTGGATATCAGATTATAAAAGAACACCATCTTTCGGGACTGATTGACTTCTT
TTGAAGTTTTGCTGATACTTCTGCAATTCTGAGGCT
  Box motif
  Complementary to target RNA
length 95
organism Arabidopsis_thaliana
snoRNA name 39BYb
alias
chromosome ⁄ contig 2
locus ⁄ host gene Poly:39BYb
organization Poly
target RNA 25S rRNA, 5.8S rRNA
modification type C/D
modification site 5.8S:G79,25S:G812
accession no AJ242537,NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved