snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana 39BYa
sequence
GCCAATGAGGACATCAGATTATAAAAGAACACCATCTTTCGGGACTGATTAACATTGAT
GATACTTCTGCAATTCTGAGG
  Box motif
  Complementary to target RNA
length 80
organism Arabidopsis_thaliana
snoRNA name 39BYa
alias
chromosome ⁄ contig 2
locus ⁄ host gene Poly:39BYa
organization Poly
target RNA 25S rRNA, 5.8S rRNA
modification type C/D
modification site 25S:G812,5.8S:G79
accession no AJ240068,NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved