snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR38Y-2
sequence
gtggatgatgagaacaaatatgaaaaaacagttatccctgtctgaggattttaatccct
ttgatgattcatttgtaatctgaca
  Box motif
  Complementary to target RNA
length 84
organism Arabidopsis_thaliana
snoRNA name SnoR38Y-2
alias
chromosome ⁄ contig 5
locus ⁄ host gene poly:SnoR88-1
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:G2805
accession no AJ240067,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved