snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR37-2
sequence
ggatgtggaaggggttgaatatggtgatgatacaagagtattgtggactagagtttcag
atctgggattcttctcccagaagttgaagattaacccttggctgtctgagtattaattcc
cctttcacc
  Box motif
  Complementary to target RNA
length 128
organism Arabidopsis_thaliana
snoRNA name SnoR37-2
alias
chromosome ⁄ contig 4
locus ⁄ host gene poly:SnoR37-2
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:C2355,25S:U2411
accession no AF317936,AF317937,AJ505638,NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved