snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR37-1
sequence
tatggtgatgaaacgaatatttcgtggactagagtttcagatctgggctcttcacccag
aatttgaagaaacaacccttggctgtctgagt
  Box motif
  Complementary to target RNA
length 91
organism Arabidopsis_thaliana
snoRNA name SnoR37-1
alias
chromosome ⁄ contig 3
locus ⁄ host gene Poly:SnoR37-1
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:C2355,25S:U2411
accession no AF317993,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved