snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR36
sequence
TTAAGATTGATGACGATGAGAAAGAGCCGATGGAATGATGATAACGATTTTTCGGATAT
ATTAATTTATTCTGTCGACCAAAACTCAGACTACAATTATCTGACTAAT
  Box motif
  Complementary to target RNA
length 108
organism Arabidopsis_thaliana
snoRNA name SnoR36
alias
chromosome ⁄ contig 4
locus ⁄ host gene poly:41Y
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:U145,25S:U1218
accession no AF318010,NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved