snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR33
sequence
GACTGTGATGGATCCTCCTCAGAGGCTGTTTCTGAAAGGTCCGACGACGGTCTCACAGA
TCTTTTTTGCACGAGCCGTTGAAGTC
  Box motif
  Complementary to target RNA
length 85
organism Arabidopsis_thaliana
snoRNA name SnoR33
alias
chromosome ⁄ contig
locus ⁄ host gene Mono:SnoR33
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:A1861,25S:A1511
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved