snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR32-1
sequence
GGACAGTGACGATTGATATTAAGGTCTCGTTCGTCGTAAAAACGGCCGTAAAAAGCCTA
TTTGCCGACCATTCTGTTATATCACCACCCATATTCTGAGTCC
  Box motif
  Complementary to target RNA
length 102
organism Arabidopsis_thaliana
snoRNA name SnoR32-1
alias
chromosome ⁄ contig 3
locus ⁄ host gene poly:SnoR32-1
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:U1263,18S:A1327
accession no AJ240080,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved