snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR31
sequence
TAGATAATGATGAAGCAAAATTAATCTAATCCAACACTTGATCTGAGAGATACTATGTG
CATCTCCAAGTGAAGTTACAACTGTTAGCTTCTGAATCTAA
  Box motif
  Complementary to target RNA
length 100
organism Arabidopsis_thaliana
snoRNA name SnoR31
alias
chromosome ⁄ contig 5
locus ⁄ host gene Poly:SnoR28-2a
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:A2901,25S:U67
accession no AF318012,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved