snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR30
sequence
ACGATGAGGATGTACAGCTCCCTCTTCTGATTAAGCTGAAGAGAATTGCTGGCAGAATC
GAACCTAAATCACTAGCCACTACTGAGTT
  Box motif
  Complementary to target RNA
length 88
organism Arabidopsis_thaliana
snoRNA name SnoR30
alias
chromosome ⁄ contig 5
locus ⁄ host gene Poly:SnoR28-2a
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:G390,25S:A943
accession no AF326227,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved