snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR29-2
sequence
gagaaatcgtggtgatgacttggaaatattcaagctcaacagaccgtaatgtaggattt
ttcctagtggaaagtcttgcgtgtgtcgataatcccgctgaactgagcgatttctc
  Box motif
  Complementary to target RNA
length 115
organism Arabidopsis_thaliana
snoRNA name SnoR29-2
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:SnoR29-2
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:G2381,25S:U2404
accession no Aj298135,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved