snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR28-2a
sequence
GGGAGGTGATGATTATTTCCCCAGATGATCGAAGCTGATTATACGGAGCGATTTTATGT
TTCTCTCTTTCAGAGAGATTCCAAGCCAATTTTCTGATCCC
  Box motif
  Complementary to target RNA
length 100
organism Arabidopsis_thaliana
snoRNA name SnoR28-2a
alias
chromosome ⁄ contig 5
locus ⁄ host gene Poly:SnoR28-2a
organization Poly
target RNA
modification type C/D
modification site
accession no NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved