snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR28-1c
sequence
GGAGGTGATGACAATTTCCCCAAATGATCGAATCAGATTATACTAAGCGATTTTTATTT
CCTTCTCAACAGAGGAAATCAAGCCAATGTTCTGATCC
  Box motif
  Complementary to target RNA
length 97
organism Arabidopsis_thaliana
snoRNA name SnoR28-1c
alias
chromosome ⁄ contig 5
locus ⁄ host gene Poly:SnoR28-1a
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:U797,18S:G825
accession no NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved