snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR25
sequence
GTTCCCTGTGATGATTTAAAATCAATACCATGCTAATGTATATTGATAATTTTTATTTG
ATTTATAAGTGATTTGCTGAGGGAAC
  Box motif
  Complementary to target RNA
length 85
organism Arabidopsis_thaliana
snoRNA name SnoR25
alias
chromosome ⁄ contig 1
locus ⁄ host gene poly:SnoR69Y
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:C795,18S:U107
accession no NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved