snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR24b
sequence
AGCTGTGATGAGAAAGCTAACACGTAAGAAGGGGTACTCCTTTGTGGGGTGTTTCTTCA
ATGAAATACATTTGTTACGCTTGGCTTCTGAGCT
  Box motif
  Complementary to target RNA
length 93
organism Arabidopsis_thaliana
snoRNA name SnoR24b
alias
chromosome ⁄ contig 4
locus ⁄ host gene Mono:U24e
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:C2404,25S:C2826
accession no AF326224,NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved