snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR23-3
sequence
GATGCAATGATGAGATGAAAGCACGAAGAGTGTGAGAAGAGCAGTGGGTTTACCGTGAG
CTCTCCTTTAAAACGACTTCTCCTTCCACTGAGCATT
  Box motif
  Complementary to target RNA
length 96
organism Arabidopsis_thaliana
snoRNA name SnoR23-3
alias
chromosome ⁄ contig 4
locus ⁄ host gene poly:SnoR37-2
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:A1754,25S:U1050
accession no AF317942,NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved