snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR23-2
sequence
GATGCAATGATGAGATAAAAGCACGAAGAGTGTGAGAAGAGCAGTGGGTTTACCGTGAG
CTCTCCTTTAAAACGACTTCTCCTTCCACTGAGCATT
  Box motif
  Complementary to target RNA
length 96
organism Arabidopsis_thaliana
snoRNA name SnoR23-2
alias
chromosome ⁄ contig 4
locus ⁄ host gene poly:SnoR37-3
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:A1754,25S:A1006
accession no AF317995,NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved