snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR21b
sequence
ggctgtgatgattgagaatgtcatgcaccactctgattttttgtgctgataatcatctc
taacccatattttatctgagc
  Box motif
  Complementary to target RNA
length 80
organism Arabidopsis_thaliana
snoRNA name SnoR21b
alias
chromosome ⁄ contig 2
locus ⁄ host gene Poly:39BYb
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:G1272
accession no AJ242536,NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved