snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR20-1
sequence
GCCAGTGATGATTAGATTCAATGGTTGCTGAACATTCAATGTTGAAAAGCATCTAACTT
GACTAGGACGGTCTGAGG
  Box motif
  Complementary to target RNA
length 77
organism Arabidopsis_thaliana
snoRNA name SnoR20-1
alias
chromosome ⁄ contig 3
locus ⁄ host gene poly:SnoR88-2
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:U1010,18S:G1660
accession no AJ276574,AF31800,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved