snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR19-1
sequence
aacagtgatgagtcagtttacagacctgtaatgattgcggtaatgatcgcattattatg
aacatctaagggactgagt
  Box motif
  Complementary to target RNA
length 78
organism Arabidopsis_thaliana
snoRNA name SnoR19-1
alias
chromosome ⁄ contig 5
locus ⁄ host gene poly:SnoR88-1
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:G1431,18S:U1445
accession no AJ276573,AJ240066,NC_003076,CP002688
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved