snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR18b
sequence
tgaagtgatgattgaactttgtttccctattggtttgatcgccgatatgatggcatacg
tattagctctatctgatc
  Box motif
  Complementary to target RNA
length 77
organism Arabidopsis_thaliana
snoRNA name SnoR18b
alias
chromosome ⁄ contig 3
locus ⁄ host gene poly:SnoR18a
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:A162,25S:A2924
accession no AF318005,AF318006,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved