snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR17
sequence
CATAGTGATGAATTATATCACAATTGTCACTACCTCTGAGGCATATTCTTGATTCGTTT
TTTTTTTTTAGATTTTGGTTTCTATCACCTTACTTCTTTAGGAGCCTGATG
  Box motif
  Complementary to target RNA
length 110
organism Arabidopsis_thaliana
snoRNA name SnoR17
alias
chromosome ⁄ contig 1
locus ⁄ host gene poly:SnoR44-2
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:A466,18S:C1651
accession no NC_003070,CP002684
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved