snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR16-2
sequence
gcaaatgaagaattgattaatttatgcttaaccactgatgaacagtgttgacaaaacat
ctccgcttattatctgatgcc
  Box motif
  Complementary to target RNA
length 80
organism Arabidopsis_thaliana
snoRNA name SnoR16-2
alias
chromosome ⁄ contig 1
locus ⁄ host gene poly:SnoR16-1
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:U36,25S:U48
accession no AF317964,AJ505642,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved