snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR14-1
sequence
CGAGGTGACGATAGAAATTCACAGGTCTGTCAATCCACTGATATATGTGATGTAATTGT
GTTCTCGACAGGTTCTGATC
  Box motif
  Complementary to target RNA
length 79
organism Arabidopsis_thaliana
snoRNA name SnoR14-1
alias
chromosome ⁄ contig 2
locus ⁄ host gene Poly:U61
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:U1232,25S:U801
accession no NC_003071
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved