snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR12-1b
sequence
TGATGGTAAAAGATGACGAAAAAAATCGTTCGGATTCCCTTTGAATTCCCTCGGGAAAG
ATGTGATCACAAACCAGCTACTTCTGATTTTACCATCA
  Box motif
  Complementary to target RNA
length 97
organism Arabidopsis_thaliana
snoRNA name SnoR12-1b
alias
chromosome ⁄ contig 4
locus ⁄ host gene Poly:SnoR12-1a
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:A943,25S:A2116
accession no AJ240077,AJ240078,NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved