snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR112
sequence
TTGGATTGGAAATATGTTCCTTATCGGCTCGTTCAATATTGAAGCAAGATTAATCTCAA
CTTCAGCTGGTTTGCTACGTAATTTACCATACGCTGCAGCGTAGGAAGTTTGAGACACTT
  Box motif
  Complementary to target RNA
length 119
organism Arabidopsis_thaliana
snoRNA name SnoR112
alias
chromosome ⁄ contig 5
locus ⁄ host gene AT5G01350
organization Intronic
target RNA
modification type H/ACA
modification site
accession no AJ505683,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved