snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR111
sequence
AAAATGGGGCAAGAGAGAGTAACGGTGTCTCTGAGTCCTTGATGAACCGGCGAGGGAAA
TCAATCTGGCCGAGATATCGTTTCAGTCGTTCTTTGTTTTGGTTTACGATCTGATTGTTG
CTCGTCCACAT
  Box motif
  Complementary to target RNA
length 130
organism Arabidopsis_thaliana
snoRNA name SnoR111
alias
chromosome ⁄ contig 1
locus ⁄ host gene Poly:SnoR111
organization Poly
target RNA
modification type H/ACA
modification site
accession no AJ505682,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved