snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR108
sequence
AGTTATAGGGGAAATGAGGAATGGTTATAATCTCGCTTTAATGCGTGATGAGCGCTCCG
CTCAAAGCCTGTTACGACTAATTGGGCGCTCCAATTTTTATACAATCTGAT
  Box motif
  Complementary to target RNA
length 110
organism Arabidopsis_thaliana
snoRNA name SnoR108
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:SnoR108
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:G211,18S:G766
accession no AJ505636,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved