snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR107
sequence
AAATCTCTGCTTTTCACTGGGTATATATTAATTAGTCGTCTCTCTCACTTGTGAGAAAT
TCTCGAGTCATTTATTGTTTTTATTTATGATGATTTGGTGCAAAATTGAAGCTTTGTTTC
TCCAGTTCAGCTGATGGAGAGTTGAGGATTTGGGATACTATTCAGCACCGTGCAGTTTCT
TCTGCTTGG
  Box motif
  Complementary to target RNA
length 188
organism Arabidopsis_thaliana
snoRNA name SnoR107
alias
chromosome ⁄ contig 4
locus ⁄ host gene EMB2757/TAN
organization Intronic
target RNA 25S rRNA
modification type C/D
modification site 25S:A63,25S:A1161
accession no AJ505635,NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved