snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR106
sequence
GAAAAGATGGGGTTGAGAATGTGATTTTGCTCTTCTTGATTCAAACCAGAGAAAGATTA
GATTTGATCTCGGAGTTTCTTGATGACACTTTGATCTAAGTTGCTTGAAGGGGATTCTTT
TTCTCCTTTGTGGTTTAGATTAAGGTAGAGAGTAATGTCGAGCTCTTATCAACATTTTTC
ATGGTTTGAGGCTTGAAGAACATTCACGTTTTTCAAGCTCACTCATGTGGACAACCTTGG
CCCTTGTCTGAGAAA
  Box motif
  Complementary to target RNA
length 254
organism Arabidopsis_thaliana
snoRNA name SnoR106
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:SnoR106
organization Mono
target RNA 25S rRNA
modification type C/D
modification site 25S:G1356,25S:U401
accession no AJ505634,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved