snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR104
sequence
GGGGAGCATCAAAGAGTTGTGATGTTATCTGATACAATCTTCCTAAATAAACACTCTGC
ATTTCCTGCTTGCGGAAGCTGAGCTTTGTTCCGCGAGTCTCATATCTGCAAAGACACTA
  Box motif
  Complementary to target RNA
length 118
organism Arabidopsis_thaliana
snoRNA name SnoR104
alias
chromosome ⁄ contig 5
locus ⁄ host gene FASS
organization Intronic
target RNA U2 snRNA
modification type H/ACA
modification site U2:U42
accession no AJ505679,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved