snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR103
sequence
CGCAAGTATGTGTTTCTGCTGTAAATATGGACGTATAATGATATGTAGGCTTTTAGGTG
GGCATTTTGTTAGCTGCTATTTGCTCATAAAGGACCTACTGACATTT
  Box motif
  Complementary to target RNA
length 106
organism Arabidopsis_thaliana
snoRNA name SnoR103
alias
chromosome ⁄ contig 5
locus ⁄ host gene eukaryotic translation initiation factor 4F, putative
organization Intronic
target RNA U5 snRNA
modification type H/ACA
modification site U5:U47,U5:U50
accession no AJ505678,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved