snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR102
sequence
agaagtcaatagaccagacattgtggtaacactctctttcatggcagggctatataagg
ataaaacttagttagcagccatggcggatgagtactgtttcctctaatttgtctgagaaa
aggcgaatctgagt
  Box motif
  Complementary to target RNA
length 133
organism Arabidopsis_thaliana
snoRNA name SnoR102
alias
chromosome ⁄ contig 1
locus ⁄ host gene Mono:SnoR102
organization Mono
target RNA 18S rRNA, U5 snRNA
modification type C/D
modification site U5:G41,18S:A760
accession no AJ505632,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved