snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR101
sequence
GGGATACACTTGATCTCTGAACTTCACAGGTAAGTTCGCTTGTTGATAACTACTGGTCT
GCTGATGCT
  Box motif
  Complementary to target RNA
length 68
organism Arabidopsis_thaliana
snoRNA name SnoR101
alias
chromosome ⁄ contig 1
locus ⁄ host gene Mono:SnoR101
organization Mono
target RNA 25S rRNA, U2 snRNA
modification type C/D
modification site U2:C29,25S:C335
accession no AJ505631,NC_003070
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved