snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR10-2
sequence
aaatatgatgataataatcagtaaatatcttaggacaccttctgacacagtttactgtg
tatgagaatgacttgttaatctgatt
  Box motif
  Complementary to target RNA
length 85
organism Arabidopsis_thaliana
snoRNA name SnoR10-2
alias
chromosome ⁄ contig 5
locus ⁄ host gene Poly:SnoR9-2
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 25S:U2641,18S:C1210
accession no AJ240070,NC_003076
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved