snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana SnoR1a
sequence
ggcgatgatgatcaatgcttaatttctgacacctcttgtatgagaagagcttgataacc
tcttctttgagcacattatgcaatactctgagc
  Box motif
  Complementary to target RNA
length 92
organism Arabidopsis_thaliana
snoRNA name SnoR1a
alias
chromosome ⁄ contig 3
locus ⁄ host gene poly:SnoR18a
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 25S:G2781,18S:U889
accession no AJ300656,NC_003074
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved