snOPY snoRNA Orthological Gene Database

Family: snoR38

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300070 TTGGATGATGAGAAACAAAAATCAAAATACAGTTATCCCTGGCTTAGGGTTTAAAGCCCG C_porcellus301034 ----------TTGAGCTGAGGATGATTTAAAGTTATCCCTGTCTGAA-----ATGCCATC C_porcellus301035 ----------CTGAGTCTGTGATGA-TTAAAGTTATCCCTGTCTGAAGGCAAAGGCCTTT C_porcellus301036 -------------CCCAATCTATGATGGTTAATTATCCCTATCTGAAA----ATCTCAGC O_anatinus303106 ----------GCGAGCTAGTGATGAGTAAAAGTTATCCCTGTCTGAAC----AAAATCCT S_pombe300072 TTGTATGATGATACT---ATTTTTTTTTACAGTTATCCCTG--------TCTAAAGCATA * ******** * A_thaliana300070 TTGCTGAGTCTTTTGTAATCTGACA----- C_porcellus301034 TTGTG-GAGTCCTGATTAC-TGAAGCTCAA C_porcellus301035 CTGTGTGGATTGTGGATCTCTGAAACTCAG C_porcellus301036 TGAAGGGAAATAATTCATTCTGAGGTTTAG O_anatinus303106 TTGTG-GAATTTTGATTTCCTGAGGCTCAG S_pombe300072 GTGTTGAGAATGGTA-AATCTGAATA---- ***

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved