snOPY snoRNA Orthological Gene Database

Family: snR70

CLUSTAL W (1.83) multiple sequence alignment D_melanogaster300040 -----------CACCCAAGGCG--ATGGGCGGACAGAATGCTACCGTACAATTGCTCTCA S_cerevisiae300058 --TGATATGATGATTTGTTGTCGACCGGGCGGACATATTAGTATCTGTTAAAGGGTCGCC S_pombe300054 TTTAAGGATGATACCTAAGACGCAACGGGCGGACTAAATGGGTTACTACAAT-GCTTCAA * ******** * * ** * * D_melanogaster300040 CCGTGTAGAGGA-CAGCCTTTCAGAT---------------------------------- S_cerevisiae300058 GTCTACTCTCAT-CGTTCTTTTGTGTACAAATTTTTTAAAGGAGCGATGTTGATGGCATT S_pombe300054 CTGTACAATGAAGTTGTAACTCACATGTTGTTATCGTGTCTTACTGAAA----------- * * * D_melanogaster300040 ----------------------------------------------- S_cerevisiae300058 ATGGTTCTTTAGTGGAGAATTGATGATTGGTCACAAGACATCTGATT S_pombe300054 -----------------------------------------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved