snOPY snoRNA Orthological Gene Database

Family: snR52

CLUSTAL W (1.83) multiple sequence alignment D_melanogaster300221 ----------------GTCTGGATGATGAAACGATGGTATCTGAATGAGCAAATTATTGT S_cerevisiae300050 TACTATGATGAATGACATTAGCGTGAACAATCTCTGATACAAAATCGAAAGATTTTAGGA * * *** ** * ** ** * ** * ** * D_melanogaster300221 TGAGAAGCCTTTTACCATCTGCTGCCTTCCTTCTGATCGG S_cerevisiae300050 TTAGAAA------AACTTATGTTGCCTTCCTTCTGAAA-- * **** * * * ** **************

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved