snOPY snoRNA Orthological Gene Database

Family: snR161

CLUSTAL 2.0.10 multiple sequence alignment D_melanogaster300057 TTGGGAGACAAAGTTTACATGCTAAAGA--TTCTC---CATTTTCCGTGTCTACAACGCT D_melanogaster300060 -CGGGAGACAAAGTTTACATGTTGAAGATGATGTGGCTTCTTTTTCGTGTCTACAATGCT D_melanogaster300062 -ATGGAGAAAAAGTTTACATGCTAAAGT--ATTTT---TCTTTTCCGTGTCTACAATGCT D_melanogaster300064 -TCGGAGACAAAGTTTACATGCTAAGGA---TAAGA--TCTTTTTCGTGTCTACAATGCT D_melanogaster300067 -GTGGAGCCAAAGTTTACACGTTAAAGTGCATTTG---TCTTTTCCATGTCTACAAGGCT D_melanogaster300069 -GTGGAGACAAAGTTTACATTTTAACAG---TATTA--TCGTTTTTATGTCTACAATGCT D_melanogaster300071 -ATGGAGACAAAGTTTACATGTTAACAA---TATTA--TCGTTTTCGTGTCTACAATGCT **** ********** * * * *** ********* *** D_melanogaster300057 CCGATATAAATTGTAACGCTTAAATCATCTTGAGTAATTCTTTTTGTTTCTTAAGATA-A D_melanogaster300060 CCAAAATAAATTGT-TCGTTTAAATCGTCTTATTCGATTTATTTTATTGCCTAAGATG-G D_melanogaster300062 CCAATATTAATTG-AACGTCTAAATCATCTTGGATA--TAATTATATTTCCATAGATA-A D_melanogaster300064 CCAAGAGCAA-ATGTTCGTTTAAATCATCCTTGGCATTCAATATTTTTGCTGTGGATGCA D_melanogaster300067 CCA-TATAAATAGTATCGTTAAAATCATCTTGAACA--T---TCTAGTTT-ATAAATA-T D_melanogaster300069 CCGAAATCAATAT--CCGATCCAATTATCCAAAGCAGTCT-TATATTTCCT-TGGATG-A D_melanogaster300071 CCAAAATCAATATATTCGATCGAATCATCCGAAGCAGTCT-TATATTTCCT-TGGATG-A ** * ** ** *** ** * ** D_melanogaster300057 ATACTTTCGTGTACATTA--- D_melanogaster300060 TTGCCAAC-TGCACAACAACT D_melanogaster300062 ATACATTCGTTCACAATA--- D_melanogaster300064 TTTAATTCGTGCACATAT--- D_melanogaster300067 ATCCAATGATAAATAC----- D_melanogaster300069 TTTCTTTCGT-TACAAAA--- D_melanogaster300071 TTTCTTTGGTGCACAGTG--- * * * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved