snOPY snoRNA Orthological Gene Database

Family: SnoR74

CLUSTAL W (1.83) multiple sequence alignment A_thaliana300105 ------GCAGGGTTCTGTTTTA-TATAACAGACCTCACGTAAATGTCAGGAAAATCGAAT A_thaliana300106 GAAAAAGCAGAGTTCTGTTGCAATTTGACAGATCTCACGTATACTTCAGGGAAATTGAAT **** ******** * * * ***** ******** * ***** **** **** A_thaliana300105 TGGTCATTGTGAATGGGTGAGCCAATGTT---ACTTCTAATAGC-ATATGGTTCAGTACA A_thaliana300106 TGGTCATCGTGATTGGGTGAATCTATGTTTATATATCTCATAACTATAAGATTCAGTACA ******* **** ******* * ***** * *** *** * *** * ********* A_thaliana300105 TGATGGTACATTTT A_thaliana300106 TGATGGTACATTG- ************

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved