snOPY snoRNA Orthological Gene Database

Family: SnR49,SnoR80

CLUSTAL 2.0.10 multiple sequence alignment A_thaliana300118 ACCAATTCTGAGGGATAAAA-ACAGTTCCTTCAGGTATAATGGCTTGTGACGCTATATTG A_thaliana300204 ACCAATTCTGAAGGATAAAA-ACAGTTCCTTCAGGTATAATGGCTTGTGACGCTATATTG A_thaliana300205 ACCAATTCTGAAGGATTAAATATGGTTCCTTTAGGTATAATGGCAT-TGACGCAATATTG *********** **** *** * ******* ************ * ****** ****** A_thaliana300118 GTTGTGGTATATCCTGATCTTTTTGCTTTTTT--CCATGCCTTTTGATCCTGGAAATGCC A_thaliana300204 GTTGTGGTATATCCTGATCTTTTTGCTTTTTT--CCATGCCTTTTGATCCTGGAAATGCC A_thaliana300205 ATTGTGGTATATCCTGATCATTTGGCTTTTTTTTCTATGTTATTTGATCCTGGAAATGCC ****************** *** ******** * *** ****************** A_thaliana300118 TCGCACATTA A_thaliana300204 TCGCACATTA A_thaliana300205 TCACACATT- ** ******

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved