snOPY snoRNA Orthological Gene Database

Family: SNORD99

CLUSTAL W (1.83) multiple sequence alignment C_familiaris300074 ACTGGTCC--AGGATGAAACCTAATCTGAGTGGACAT-CTATGGATGATA C_porcellus300394 ACTGGTCC--AGGATGAAACCTAATCTGAGTGGACAT-CTGTGGATGAGA D_rerio300046 ACTGATCA--AGGATGATAGTATATTG--ATGGTGAC-TGCTGGATGAAA E_telfairi300230 GCTGTATTCAAGGATGAAACCTATTCTGAGTGGACAT-ATATGGATGATA E_telfairi300489 CCTGGTCA--AGGATGAAACCTAATCTGAGTGGACAT-CTCCGGATGATA E_telfairi300625 GTAGGTCACCTACTTTAAAGCAAAC--AAGTG-ACAT-CTATGGATGATA E_caballus300004 ACTGGTCC--AGGATGAAACCTAATCTGAATGGACAT-CTATGGATGATA E_europaeus300053 ACTGGTCA--AGGATGAAAACCTATCTCTGTGGACAT-CATTGGATGATA E_europaeus300340 ATTGGTCA--AGGATGAAAACCTATCTCTGTGGACAT-CATTGGGTGATA G_aculeatus300019 -GTGATCT--ATGATGATTCAATACTAAAATTGTGAC-TGCTGGATGAAG H_sapiens300651 ACTGGTCC--AGGATGAAACCTAATTTGAGTGGACAT-CCATGGATGAGA L_africana300173 ACTGGTCC--AGGATGAAACCTAATCTGAGTGGACAT-CTGTGGATGATA M_mulatta300214 ACTGGTCC--AGGATGAAAC--AATCTGAGTGGACAT-CCATGGATGAGA M_domestica300062 ACTGGTCA--GTGATGAATCTCTTATCTGGTGGACATGCTTTGGATGACA M_musculus300613 ACTGGTCC--ATGATGAAACCCATTATCAGTGGACAT-CTATGGATGAGA M_lucifugus300900 ACTGGTCT--GGGATGAAACCTAATCTGAGTGGACAT-CTGTGGATGATA O_anatinus303291 GCTGGTTA--AGGATGACACTCAAT---GGTGGACAT-GTATGGATGACA O_cuniculus300205 ACTGGTCC--AGGATGAATCCTAATCTGAGTGGACAT-CTTTGGATGAGA O_latipes300040 TCTGATCC--ATGATGACTTCCAAACAC-ATGTGGAC-TGTTGGATGAAG P_troglodytes300511 ACTGGTCC--AGGATGAAACCTAATTTGAGTGGACAT-CCATGGATGAGC P_pygmaeus300607 ACTGGTCC--AGGATGAAACCTAATTTGAGTGGACAT-CCATGGATGAGA S_araneus301081 GCTGGTTC--AGGATGAAACCTTATCTGAGTGGACAT-CTATGGATGATA S_tridecemlineatus300294 ACTGGTCC--AGGATGAAACCTAATCTGAATGGACAT-CTATGGATGAGA T_nigroviridis300174 TCTGATCT--GTGATGATGCCTAAATG--ATGAGGAC-TGCTGGATGAAG T_belangeri300185 AGTGGTCC--GGGATGAAGCCTAGTCTGAGTGGACAT-CT--GGATGAGA X_tropicalis300028 GCTGCGCG--GGGATGAATCTCTTATCTGG-AGACGG---TTGGATGAAT X_tropicalis300029 TCTGTGTG--GGGATGAATCCCTTATCTGG-AGACGG---TTGGATGAAT X_tropicalis300030 GCTGTGCG--GGGATGAATCTCTTATCTGG-AGACGG---TTGGATGAAT * * * ** *** C_familiaris300074 AATGCGGATATGGGACTGAGACCAGCTCTTCAG C_porcellus300394 AATGCGGATATGGGACTGAGACCAGTGCTTAGG D_rerio300046 CTTGCGGATATGGGACTGAGATCAGTT------ E_telfairi300230 AATACGGATATGGGACTGAGACCAGCTGCTCGA E_telfairi300489 AATGCGGATATGGGACTGAGACCAGCTGCTTGA E_telfairi300625 AATGAGGATTTGGGACTGAGACCAGCTGCTCCT E_caballus300004 GATGCGGATATGGGACTGAGACCAGCTTTTAGG E_europaeus300053 GATGCGGATATGGGACTGAGACCAGTTCTAGGG E_europaeus300340 AATGTGGATATGGGACTGAGACCAGTTCTTGGG G_aculeatus300019 CTTGCGGATATGGGACTGAGATCAGCATTTCAA H_sapiens300651 AATGCGGATATGGGACTGAGACCAGCTCCTAGG L_africana300173 AATGCGGATATGGGACTGAGACCAGCTCTTAGA M_mulatta300214 AATGCGGATATGGGACTGAGACCAGCTCCTAGG M_domestica300062 CTTGCGGATATGGGGCTGAGACCAGTCACAAGC M_musculus300613 AATGCGGATATGGGACTGAGACCAGTTCTTAGG M_lucifugus300900 AATGCGGATATGGGACTGAGACCAGCT------ O_anatinus303291 CTTGCGGATATGGGACTGAGACCAGCT------ O_cuniculus300205 AATGCGGATATGGGACTGAGACCAGCTCTTGGG O_latipes300040 CATGCGGATATGGGACTGAGATCAGACTTTAGC P_troglodytes300511 AATGCGGATATGGGACTGAGACCAGCTCCTAGG P_pygmaeus300607 AATGCGGATATGGGACTGAGACCAGCTCCTAGG S_araneus301081 AATGCGGATATGGGACTGAGACCTGCTGTTTGA S_tridecemlineatus300294 AATGCGGATATGGGACTGAGACCAGCTCTTAGG T_nigroviridis300174 CTTGCGGATATGGGACTGAGATCAGCC------ T_belangeri300185 GAAGCGGATATGGGGTTGAGACTAGCTCGGGGA X_tropicalis300028 CTTGCGGATATGGGACTGAGCGCAGCCGTTGCC X_tropicalis300029 CTTGCGGATATGGGACTGAGCACAGGCGCCTCC X_tropicalis300030 CTTGCGGATATGGGACTGAGCGCAGCCTTTGCC **** **** **** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved