snOPY snoRNA Orthological Gene Database

Family: SNORD98

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300347 ------------------------GAGTTATGATGTAT--AAATCCTATT C_porcellus300923 ------------------------GAGTTATGATGTGT--AAATCCTATT D_melanogaster300129 CACCAAATGAAGAAAGTTTTAGGTAATTTCAGAAGCATTAAAAAGACATT E_telfairi300735 ------------------------GAGTTGTGATGTGTA-AA-TCCTATT E_caballus300358 ------------------------GAGTTATGATGTGT--AAATCCTATT E_europaeus300647 ------------------------GAGTTATGATGTGT--AAATCCTATT H_sapiens300472 ------------------------GAGTTATGATGTGTGTAAATCCTATT L_africana300524 ------------------------GAGTTATGATGTGT--AAATCCTATT M_mulatta300594 ------------------------GAGTTATGATGTGTGTAAATCCTATT M_murinus300501 ------------------------GAGTTATGATGTGT--AAATCCTATT M_domestica300107 ------------------------GAGTTGTGATGAGTA-AAATCCTATT M_domestica300118 ------------------------ATGTTATGATGAATA-AAATCCTGTT O_cuniculus300520 ------------------------GAGTTATGATGTGT--AAATCCTATT O_garnettii300712 ------------------------GAGTTATGATGTGT--AAATCCTATT P_troglodytes300717 ------------------------GAGTTATGATGTGTGTAAATCCTATT P_pygmaeus300667 ------------------------GAGTTATGATGTGTGTAAATCCTATT R_norvegicus300963 ------------------------GAGTTATGATGTGT--AAATCCTATT S_araneus300969 ------------------------GAGTTATGATGTGT--AAATCCTATT S_tridecemlineatus300273 ------------------------GAGTTATGATGTGT--AAATCCTATT T_belangeri300404 ------------------------GAGTTATGATGTGT--AAATCCTATT ** ** * * ** ** C_familiaris300347 CCATTG----CTGAAATGCAGTGTGGAACACGATGAACTGAACTC----- C_porcellus300923 CCATTG----CTGAAATGCAGTGTGGAACACGATGAACTGAACTC----- D_melanogaster300129 AAGTAGGAACCTAAAAGTAAGCAAAAACTAGTGCATTTTATATTTCATTA E_telfairi300735 CCATTG----CTGAACTGCAGTGTGGAA-ATGATGAACTGAACTC----- E_caballus300358 CCATTG----CTGAAATGCAGTGTGGAACACGATGAACTGAACTC----- E_europaeus300647 CCATTG----CTGAAATGCAGTGTGGAACACGATGAACTGAACTC----- H_sapiens300472 CCATTG----CTGAAATGCAGTGTGGAACACAATGAACTGAACTC----- L_africana300524 CCATTG----CTGAAATACAGTGTGGAACATGTTGAACTGAACTC----- M_mulatta300594 CCATTG----CTGAAATGCAGTGTGGAACACAATGAACTGAACTC----- M_murinus300501 CCATTG----CTGAAATGCAGTGTGGAACACGATGAACTGAACTC----- M_domestica300107 CCATTG----CTGAAATACAGTGTGGAACATGATGAACTGAGCTC----- M_domestica300118 CCATTG----CTAAAATACAGTATGGATTATGATGAAATAAACTT----- O_cuniculus300520 CCATTG----CTGAAATGCAGTGTGGAACACGATGAACTGAACTC----- O_garnettii300712 CCATTG----CTGAAATGCAGTGTGGAACACGATGAACTGAACTC----- P_troglodytes300717 CCATTG----CTGAAATGCAGTGTGGAACACAATGAACTGAACTC----- P_pygmaeus300667 CCATTG----CTGAAATGCAGTGTGGAACACAATGAACTGAACTC----- R_norvegicus300963 CCATTG----CTGAAATGCAGTGTGGAACATGATGAACTGAACTC----- S_araneus300969 CCATTG----CTGAAATGCAGTGTGGAACACGATGAACTGAACTC----- S_tridecemlineatus300273 CCATTG----CTGAAATGCAGTGTGGAACACAATGAACTGAACTC----- T_belangeri300404 CCATTG----CTGAAATGCAGTGTGGAACACAATGAACTGAACTC----- * * ** ** ** * * * * C_familiaris300347 -------- C_porcellus300923 -------- D_melanogaster300129 CTGAGGAA E_telfairi300735 -------- E_caballus300358 -------- E_europaeus300647 -------- H_sapiens300472 -------- L_africana300524 -------- M_mulatta300594 -------- M_murinus300501 -------- M_domestica300107 -------- M_domestica300118 -------- O_cuniculus300520 -------- O_garnettii300712 -------- P_troglodytes300717 -------- P_pygmaeus300667 -------- R_norvegicus300963 -------- S_araneus300969 -------- S_tridecemlineatus300273 -------- T_belangeri300404 --------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved