snOPY snoRNA Orthological Gene Database

Family: SNORD96

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300331 ----------CATCCCAGTGATGACA-GATGACATTGTCAGCCAATCCCT C_porcellus300898 ----------GATCCTGGTGATGACA-GATGACATTGTCAGCCAATCCC- D_melanogaster300082 -----------CTTGCTCTGATGACA--AAAACACGAAAAGAACAATCAT E_telfairi300705 ----------GATCCTAGTGATGACA-GACGACATTGTCACCTGATCCCC E_caballus300235 ----------GATCCTGGTGATGATA-GACCACATTGTCAGCCAATCCCC E_europaeus300172 ----------GATCCTGATGATGATAATAAGACATTGTTAACCTGATCCC E_europaeus300563 ----------AATCCTGATGATGATAATAAGACATTGTTAACCTGATCCC H_sapiens300555 -------------CCTGGTGATGACA-GATGGCATTGTCAGCCAATCCCC H_sapiens300641 ----------GATCCTGGTGATGACA-GACGACATTGTCAGCCAATCCCC L_africana300498 -----------ATCCTGGTGATGACA-GATGACATTGTCAGCTGATCCCC M_mulatta300695 -----------ATCCTGGTGATGACA-GATGACATTGTCAGTCAATCCCC M_mulatta300728 -----------GTCCTGGTGATGACA-GATGACATTGTCAGCCAATCCCC M_murinus300443 -----------GTCCTGGTGATGATG-GACGACATTGTCAGCCAACCCCC M_musculus300931 ----------GATCCTAGTGATGACAAGACGACATTGTCAACCAATCCCC O_cuniculus300439 ----------GATCCTGGTGATGACA-GATGACATTGTCAGCCAATCCCC O_garnettii300742 -----------GTCCTGGTGATGACA-GATGACATTGTCAGCCAACCCCC P_troglodytes300503 ----------GATCCTGGTGATGACA-GACGACGTTGTCAGCCAATCCCC P_troglodytes300715 -----------GTCCTGGTGATGACA-GATGGCATTGTCAACCAATCCCC P_pygmaeus300615 ----------GATCCTGGTGATGACA-GACGACGTTGTCAGCCAATCCCC P_pygmaeus300756 -----------GTCCTGGTGATGACA-GATGACATTGTCAGCCAATCCCC S_araneus300940 ----------GATCCTGGTGATGATC-AGTGACATGATCAGCCAATCCCC S_tridecemlineatus300162 TCAATTATTTGAGGAAAACAAAA--ATAACATCTTTGGGGACTGAATAAT S_tridecemlineatus300297 ----------GATCCTGGTGATGACA-GATGACATTGTCACCCAATCCCC X_tropicalis300118 ----------GAGCGAAGTGATGGTATACCATCTTTCGGGACTGAATCCC * * C_familiaris300331 -ACGTGGGA-GTGAGGACATGTCCTGCAATTCTGAAGGGATA C_porcellus300898 -ACAAGGGA-ATGAGGACATGTCCTGCAATTCTGAGTGGATT D_melanogaster300082 --GTTGAGA---CACTATGTGTCCTGCAGTGCTGAGCTT--- E_telfairi300705 -GTGTGGGA-GTGAGGACATGTCCTGCAATTCTGAATGGATT E_caballus300235 -ACGTGGGA-ATGAGGACATGTCCTGCAATTCTGAAGGGATT E_europaeus300172 CACGTGGGG-TTGAGGACAAGTCCTGCAATTCTGAAAGGGTT E_europaeus300563 CACGTGGGGGTTGAGGACAAGTCCTGCAATTCTGAAAGGGTT H_sapiens300555 -AAGTGGGA-GTGAGGACATGTCCTGCAATTCTGAAGG---- H_sapiens300641 -ATGTGGTA-GTGAGGACATGTCCTGCAGTTCTGAAGGGATT L_africana300498 -ATGTGGGA-GTGAGGACATGTCCTGCAATTCTGA-GGGAT- M_mulatta300695 -ATGTGGTA-GTGAGGGCATGTCCTGCAGTTCTGAAGAAA-- M_mulatta300728 -ATGTGGGA-GTGAGGACATGTCCTGCAATTCTGAAGGGA-- M_murinus300443 -ACGTGGGA-GTGAGGACATGTCCTGCAATTCTGAAGGGA-- M_musculus300931 CACAAGGGA-ATGAGGACATGTCCTGCAATTCTGAATGGGTT O_cuniculus300439 -ATGTGGGA-GTGAGGACATGTCCTGCAATTCTGAAGGGATT O_garnettii300742 -ACGTGGGA-GTGAGGACATGTCCTGCAATTCTGAAGGGA-- P_troglodytes300503 -ATGTGGTA-GTGAGGACATGTCCTGCAGTTCTGAAGGGATT P_troglodytes300715 -AAGTGGGA-GTGAGGACATGTCCTGCAATTCTGAAGGGA-- P_pygmaeus300615 -ATGTGGTA-GTGAGGACATGTCCTGCAGTTCTGAAGGGATT P_pygmaeus300756 -AAGTGGGA-GTGAGGACATGTCCTGCAATTCTGAAGGGA-- S_araneus300940 -ATGTGGGA-ATGAGGACATGTCCTGCAATTCTGAAGGGATT S_tridecemlineatus300162 TTGATGATAATAAAGGCAATCTCAATTGA------------- S_tridecemlineatus300297 -ACAAGGAA-ATGAGGACATGTCCTGCAATTCTGAGTGGATT X_tropicalis300118 CTGATGACATCTTAATAAAACT-GATCGCTC----------- * * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved